Part Three: Gene Expression and Protein Synthesis (2023)

<![if !supportEmptyParas]><![endif]>

B M B 400, third part

Gene expression and protein synthesis.

Section IV = Chapter 13

GENETIC CODE

<![if !supportEmptyParas]><![endif]>

Overview of the genetic code and translation:

<![if !supportEmptyParas]><![endif]>

Once transcription and processing of rRNA, tRNA, and snRNA is complete, the RNAs are ready for use in the cell: they are assembled into ribosomes, or snRNPs, and used in splicing and protein synthesis.But the mature mRNA is not yet functional for the cell. It has to be translated into the encoded protein. The rules for translating the "language" of nucleic acids into that of proteins are as follows:Genetic code🇧🇷 Experiments testing the effects of frameshift mutations showed that deletion or addition of 1 or 2 nucleotides caused loss of function, while deletion or addition of 3 nucleotides allowed substantial functions to be retained. This showed that the coding unit comprises 3 nucleotides. The trio of nucleotides encoding an amino acid is denoted asa code. Each group of three nucleotides codes for an amino acid. Since there are 64 combinations of 4 nucleotides each and only 20 amino acids, the code isdegenerate(in most cases more than one codon per amino acid). The adapter molecule for translation isARNt. A charged tRNA has an amino acid on one end and an anticodon on the other end to match a codon on the mRNA; it "speaks the language" of nucleic acids at one end and the "language" of proteins at the other end. The machinery for synthesizing proteins under the direction of the mRNA template is theribosomes.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Figure 3.4.1. tRNAs serve as adapters for the translation of nucleic acid into protein.

<![si !vml]>Part Three: Gene Expression and Protein Synthesis (1)<![finish]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

ONE. codon size: 3 nucleotides

<![if !supportEmptyParas]><![endif]>

1. Three is the minimum number of nucleotides per codon needed to encode 20 amino acids.

<![if !supportEmptyParas]><![endif]>

one. 20 amino acids are encoded by combinations of 4 nucleotides

<![if !supportEmptyParas]><![endif]>

b. If a codon consisted of two nucleotides, the set of all combinations could only code for

<![if !supportEmptyParas]><![endif]>

4x4 = 16 amino acids.

<![if !supportEmptyParas]><![endif]>

C. With three nucleotides, the set can encode all combinations

<![if !supportEmptyParas]><![endif]>

4x4x4 = 64 amino acids

(i.e. 64 different combinations of four nucleotides, taken three at a time).

<![if !supportEmptyParas]><![endif]>

2. The results of the frameshift mutation combinations show that the code is in triplets.

<![if !supportEmptyParas]><![endif]>

Length-altering mutations that add or delete one or two nucleotides have a severely defective phenotype (they shift the reading frame so that the entire amino acid sequence is altered after the mutation). But those that add or remove three nucleotides have little or no effect. In the latter case, the reading frame is conserved, with insertion or deletion of an amino acid at one site. Combinations of three different single nucleotide deletions (or insertions), each individually exhibiting a loss-of-function phenotype, can restore essential gene function. The wild-type reading frame is converted after the thirdthirdEliminate (or Take).

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

B. Experiments to crack the code.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

1. Several different cell-free systems have been developed for this purpose.catalyze protein synthesis. This ability to perform in vitro translation was one of the technical advances researchers needed to determine the genetic code.

<![if !supportEmptyParas]><![endif]>

one. Mammalian reticulocytes (rabbits): Ribosomes actively produce a lot of globin.

<![if !supportEmptyParas]><![endif]>

b. Wheat germ extracts

<![if !supportEmptyParas]><![endif]>

C. bacterial extracts

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

2. the ability tosynthesize random polynucleotidesit was another important development to allow experiments to crack the code.

<![if !supportEmptyParas]><![endif]>

S. Ochoa isolated the enzymePolynucleotido-phosphorilaseand showed that it was capable of binding nucleosidesforaPhosphates (NDP) on NMP polymers (RNA) in a reversible reaction.

<![if !supportEmptyParas]><![endif]>

nNDPnorte+nPyou

<![if !supportEmptyParas]><![endif]>

The physiological function of polynucleotide phosphorylase is to catalyze the reverse reaction used in RNA degradation. However, in a cell-free system, the forward reaction is very useful to produce random RNA polymers.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

3. Homopolymers program the synthesis of specific homopolypeptides

(Nirenberg and Matthew, 1961).

<![if !supportEmptyParas]><![endif]>

one. If you supply only UDP as a substrate for polynucleotide phosphorylase, the product will be a poly(U) homopolymer.

<![if !supportEmptyParas]><![endif]>

b. Addition of poly(U) to an in vitro translation system (e.g., E. coli lysates) results in a newly synthesized polypeptide that is a polymer of polyphenylalanine.

<![if !supportEmptyParas]><![endif]>

C. Portanto, UUU codes for Phe.

<![if !supportEmptyParas]><![endif]>

d. Also programmed poly(A) synthesis of poly-Lys; AAA Lys encoding.

Síntese Programada Poly(C) da Poly-Pro;CCC Codes Pro.

Sit programmed from Poly(G) from Poly-Gly;GGG codifica Gly.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

4. Use of mixed copolymers

<![if !supportEmptyParas]><![endif]>

one. When two NDPs are mixed in a known ratio, polynucleotide phosphorylase forms a mixed copolymer into which the nucleotide is incorporated at a frequency proportional to its presence in the original mixture.

<![if !supportEmptyParas]><![endif]>

b. For example, consider a 5:1 mixture of A:C. The enzyme uses ADP 5/6 of the time and CDP 1/6 of the time.An example of a possible product is:

<![if !supportEmptyParas]><![endif]>

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Table 3.4.1. Triplet frequency in a poly(AC) random copolymer (5:1).

<![if !supportEmptyParas]><![endif]>

composition

Number

probability

relative frequency

3A

1

0,578

1,0

2A, 1C

3

3x0.116

3x0.20

1A, 2C

3

3x0.023

3x0.04

3c

1

0,005

0,01

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

C. Therefore, the frequency with which AAA occurs in the copolymer is

(5/6)(5/6)(5/6) =0,578.

<![if !supportEmptyParas]><![endif]>

This is the most common codon and can be normalized to 1.0 (0.578/0.578 = 1.0).

<![if !supportEmptyParas]><![endif]>

d. The frequency with which a codon appears with 2 A and 1 C is

(5/6)(5/6)(1/6) =0,116.

<![if !supportEmptyParas]><![endif]>

There are three ways to have 2 A and 1 C i.e. AAC, ACA and CAA.

Therefore, the frequency of occurrence of all A2The C codons are 3 x 0.116.

Normalize to AAA with a relative frequency of 1.0, the frequency of A2The codons are 3 x (0.116/0.578) = 3 x 0.2.

<![if !supportEmptyParas]><![endif]>

mi. Similar logic shows that the expected frequency of AC2codons is 3 x 0.04 and the expected CCC frequency is 0.01.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Table 3.4.2. Incorporation of amino acids using poly(AC)(5:1) as a model

<![if !supportEmptyParas]><![endif]>

<![yes !support unaligned columns]><![finish]>

Radioactive

precipitable cpm

<![if !supportEmptyParas]><![endif]>

observed

theoretically

amino acids

- model

+ Model

inclusion

inclusion

lysine

60

4615

100,0

100

threonine

44

1250

26,5

24

asparagina

47

1146

24.2

20

glutamine

39

1117

23.7

20

proline

14

342

7.2

4.8

histidine

282

576

6.5

4

<![if !supportEmptyParas]><![endif]>

These data are from Speyer et al. (1963) Cold Spring Harbor Symposium on Quantitative Biology, 28:559. Theoretical embedding is the expected value for a given genetic code determined later.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

F. When this combination of mixed copolymers is used to program in vitro translation, Lys is incorporated at the highest frequency, which can be expressed as 100. This confirms that AAA encodes Lys.

<![if !supportEmptyParas]><![endif]>

grama. Regarding Lys incorporation, as100, Thr, Asn and Gln are incorporated with values ​​ranging from 24 to 26, which is very close to what would be expected for amino acids derived from any of the A.2C codons. However, these data do not indicate which of the A2Codons code for each specific amino acid.We now know that ACA codes for Thr, AAC codes for Asn, and CAA codes for Gln.

<![if !supportEmptyParas]><![endif]>

H. Pro and His are incorporated with values ​​of 6 and 7, which are close to the 4 expected for AC-encoded amino acids.2codon. For example, CCA encodes Pro, CAC encodes His. ACC encodes Thr, but this incorporation is obfuscated by the "26.5" incorporation units in ACA. Or more precisely "26.5".@20 (ACA) + 4 (ACC) per Thr.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

5. Defined trinucleotide codons stimulate binding of aminoacyl-tRNA to ribosomes

<![if !supportEmptyParas]><![endif]>

one. At high levels of magnesium cations, the normal initiation mechanism that requires f-Met-tRNAF, can be knocked out and the defined trinucleotides can be used to direct binding of specific labeled aminoacyl-tRNA to ribosomes.

<![if !supportEmptyParas]><![endif]>

b. For example, when ribosomes are mixed with UUU and radiolabeled Phe-tRNAfaithUnder these conditions, a ternary complex is formed which adheres to the nitrocellulose ("Millipore assay", name of the manufacturer of the nitrocellulose).

<![if !supportEmptyParas]><![endif]>

C. Then all possible combinations of nucleotide triplets can be tested.

<![if !supportEmptyParas]><![endif]>

Knitting. 3.4.2.

<![if !supportEmptyParas]><![endif]>

<![si !vml]>Part Three: Gene Expression and Protein Synthesis (2)<![finish]>

<![if !supportEmptyParas]><![endif]>

Data from Nirenberg and Leder (1964) Science 145:1399.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

6. Synthetic polynucleotides with a repetitive sequence(Corona)

<![if !supportEmptyParas]><![endif]>

one. Alternating copolymers: e.g. (UC)nortePrograms that incorporate Ser and Leu.

<![if !supportEmptyParas]><![endif]>

Therefore, UCU and CUC encode Ser and Leu, but cannot tell which is which. But when combined with other data, such as the randomly mixed copolymers in Section 4 above, some final determinations can be made. Such later work showed that UCU encoded Ser and CUC encoded Leu.

<![if !supportEmptyParas]><![endif]>

b. Poly(AUG) programs the incorporation of Poly-Met and Poly-Asp at high Mg concentrations. AUG encodes Met, UGA is a stop, so GUA must encode Asp.

<![if !supportEmptyParas]><![endif]>

C. the genetic code

<![if !supportEmptyParas]><![endif]>

1. By compiling observations from experiments such as those described in the previous section, the coding capacity of each set of 3 nucleotides was determined. This is known as theGenetic code. It is summarized in Table 3.4.4. that introduces uslike the cell phonetranslated from the "language" of nucleic acids(polymers of nucleotides)for the proteins(Amino acid polymers).

<![if !supportEmptyParas]><![endif]>

Knowledge of the genetic code makes it possible to predict the amino acid sequence of any sequenced gene. Whole genome sequences from several organisms have revealed genes that encode many previously unknown proteins. An important current task is to assign activities and functions to these newly discovered proteins.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Table 3.4.4. the genetic code

<![if !supportEmptyParas]><![endif]>

position in the codon .

<![yes !support unaligned columns]><![finish]>

1

2 .

<![if !supportEmptyParas]><![endif]>

3

<![if !supportEmptyParas]><![endif]>

you .

<![if !supportEmptyParas]><![endif]>

C .

<![if !supportEmptyParas]><![endif]>

ONE .

<![if !supportEmptyParas]><![endif]>

GRAMS .

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

you

vaya

faith

<![if !supportEmptyParas]><![endif]>

UCU

to be

<![if !supportEmptyParas]><![endif]>

INCREDIBLE

Tyr

<![if !supportEmptyParas]><![endif]>

THE MOST

Cis

<![if !supportEmptyParas]><![endif]>

you

<![if !supportEmptyParas]><![endif]>

UUC

faith

<![if !supportEmptyParas]><![endif]>

UCC

to be

<![if !supportEmptyParas]><![endif]>

User Account Control

Tyr

<![if !supportEmptyParas]><![endif]>

CGU

Cis

<![if !supportEmptyParas]><![endif]>

C

<![if !supportEmptyParas]><![endif]>

OR

leu

<![if !supportEmptyParas]><![endif]>

UCA

to be

<![if !supportEmptyParas]><![endif]>

OR

expression

<![if !supportEmptyParas]><![endif]>

UGA

expression

<![if !supportEmptyParas]><![endif]>

ONE

<![if !supportEmptyParas]><![endif]>

UUG

leu

<![if !supportEmptyParas]><![endif]>

UCG

to be

<![if !supportEmptyParas]><![endif]>

UAG

expression

<![if !supportEmptyParas]><![endif]>

UGG

TRP

<![if !supportEmptyParas]><![endif]>

GRAMS

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

C

CUU

leu

<![if !supportEmptyParas]><![endif]>

central unit

professional

<![if !supportEmptyParas]><![endif]>

CAU

already drunk

<![if !supportEmptyParas]><![endif]>

ZGE

Argentina

<![if !supportEmptyParas]><![endif]>

you

<![if !supportEmptyParas]><![endif]>

CUC

leu

<![if !supportEmptyParas]><![endif]>

CCC

professional

<![if !supportEmptyParas]><![endif]>

CAC

already drunk

<![if !supportEmptyParas]><![endif]>

CGC

Argentina

<![if !supportEmptyParas]><![endif]>

C

<![if !supportEmptyParas]><![endif]>

LUFT

leu

<![if !supportEmptyParas]><![endif]>

CCA

professional

<![if !supportEmptyParas]><![endif]>

CAA

gln

<![if !supportEmptyParas]><![endif]>

CGA

Argentina

<![if !supportEmptyParas]><![endif]>

ONE

<![if !supportEmptyParas]><![endif]>

CUG

leu

<![if !supportEmptyParas]><![endif]>

CCG

professional

<![if !supportEmptyParas]><![endif]>

Y

gln

<![if !supportEmptyParas]><![endif]>

CGG

Argentina

<![if !supportEmptyParas]><![endif]>

GRAMS

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

ONE

Australia

Swindler

<![if !supportEmptyParas]><![endif]>

air conditioning

thr

<![if !supportEmptyParas]><![endif]>

UCA

as

<![if !supportEmptyParas]><![endif]>

AGU

to be

<![if !supportEmptyParas]><![endif]>

you

<![if !supportEmptyParas]><![endif]>

abc

Swindler

<![if !supportEmptyParas]><![endif]>

CAC

thr

<![if !supportEmptyParas]><![endif]>

compatible communication

as

<![if !supportEmptyParas]><![endif]>

CAG

to be

<![if !supportEmptyParas]><![endif]>

C

<![if !supportEmptyParas]><![endif]>

DO NOT DO

Swindler

<![if !supportEmptyParas]><![endif]>

ACA

thr

<![if !supportEmptyParas]><![endif]>

AAA

Lys

<![if !supportEmptyParas]><![endif]>

BUT

Argentina

<![if !supportEmptyParas]><![endif]>

ONE

<![if !supportEmptyParas]><![endif]>

August*

date

<![if !supportEmptyParas]><![endif]>

ACG

thr

<![if !supportEmptyParas]><![endif]>

AAG

Lys

<![if !supportEmptyParas]><![endif]>

AGG

Argentina

<![if !supportEmptyParas]><![endif]>

GRAMS

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

GRAMS

GUU

vale

<![if !supportEmptyParas]><![endif]>

AGB

ala

<![if !supportEmptyParas]><![endif]>

GAU

Asp

<![if !supportEmptyParas]><![endif]>

GGU

gly

<![if !supportEmptyParas]><![endif]>

you

<![if !supportEmptyParas]><![endif]>

GUC

vale

<![if !supportEmptyParas]><![endif]>

CCG

ala

<![if !supportEmptyParas]><![endif]>

NO

Asp

<![if !supportEmptyParas]><![endif]>

GGC

gly

<![if !supportEmptyParas]><![endif]>

C

<![if !supportEmptyParas]><![endif]>

GUA

vale

<![if !supportEmptyParas]><![endif]>

GCA

ala

<![if !supportEmptyParas]><![endif]>

BUT

Cola

<![if !supportEmptyParas]><![endif]>

GGA

gly

<![if !supportEmptyParas]><![endif]>

ONE

<![if !supportEmptyParas]><![endif]>

GUG*

vale

<![if !supportEmptyParas]><![endif]>

GCC

ala

<![if !supportEmptyParas]><![endif]>

SNAP

Cola

<![if !supportEmptyParas]><![endif]>

GGG

gly

<![if !supportEmptyParas]><![endif]>

GRAMS

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

* Sometimes used as a start codon.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

2. Of the total 64 codons, 61 encode amino acids and 3 specify translation termination.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

3. degeneration

<![if !supportEmptyParas]><![endif]>

one. Whatdegenerationof the genetic code refers to the fact that most amino acids are specified by more than one codon. Exceptions are methionine (AUG) and tryptophan (UGG).

<![if !supportEmptyParas]><![endif]>

b. Degeneration is mostly found in the third position. Consequently, single nucleotide substitutions at the third position must not result in a change in the encoded amino acid. these are calledIn silenceoequivalentNucleotide substitutions. They do not alter the encoded protein. This is discussed in more detail below.

<![if !supportEmptyParas]><![endif]>

C. The degeneracy pattern allows codons in "The family"eu"couples".Nucleotides are in the first two positions in 9 groups of codons.enoughto specify a single amino acid, and each nucleotide (abbreviated as N) in the third position encodes the same amino acid.These include "families" of 9 codons. One example is the ACN, which encodes threonine.

<![if !supportEmptyParas]><![endif]>

There are 13 "pairs" of codons in which the nucleotides in the first two positions are sufficient to specify two amino acids. A purine nucleotide (R) in the third position specifies one amino acid, while a pyrimidine nucleotide (Y) in the third position specifies the other amino acid.

<![if !supportEmptyParas]><![endif]>

These examples add up to more than 20 (the number of amino acids), as leucine (encoded by UUR and CUN), serine (encoded by UCN and AGY), and arginine (encoded by CGN and AGR) also share a codon family. encoded by a pair of codons. UAR codons that specify translation completion were counted as a codon pair.

<![if !supportEmptyParas]><![endif]>

The three codons that encode isoleucine (AUU, AUC and AUA) are halfway between a codon family and a codon pair.

<![if !supportEmptyParas]><![endif]>

mi. The codons for leucine and arginine, with a codon family and a codon pair, provide the few examples of degeneracy in the first codon position. For example, both UUA and CUA encodeucine. No degeneracy is observed at the second codon position for codons encoding amino acids. The only instance of a second positional degeneracy involves the UAA and UGA stop codons.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

4. Chemically similar amino acids usually have similar codons.

<![if !supportEmptyParas]><![endif]>

For example, hydrophobic amino acids are typically encoded by codons with a U in the second position, and all codons with a U in the second position encode hydrophobic amino acids.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

5. The lead codon that specifies the start of translation is AUG..

<![if !supportEmptyParas]><![endif]>

Bacteria can also use GUG or UUG and very rarely AUU and possibly CUG. Using data from the 4288 genes identified by the complete genome sequence ofE. coli, the following frequency of codon initiation usage was determined:

<![if !supportEmptyParas]><![endif]>

AUG is used for 3542 genes.

GUG is used to 612 gen.

UUG is used to 130 gen.

AUU is used to 1 generation

CUG can be used to 1 generation

<![if !supportEmptyParas]><![endif]>

Regardless of the codon used for initiation, the first amino acid incorporated during translation in bacteria is f-Met.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

6. Three codons specify the end of translation: UAA, UAG, UGA.

<![if !supportEmptyParas]><![endif]>

Of these three codons, UAA is the most used inE. coli, followed by UGA. UAG is used much less often.

<![if !supportEmptyParas]><![endif]>

UAA is used for 2705 genes.

UGA is used for 1257 genes.

UAG is used to 326 gen.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

7. The genetic code isfastUniversal-.

<![if !supportEmptyParas]><![endif]>

In the rare exceptions to this rule, the differences with the genetic code are quite small. An exception is, for example, mitochondrial DNA RNA, where both UGG andUGAencode trp.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

D. Use of differential codon

<![if !supportEmptyParas]><![endif]>

1. Different species have different codon usage patterns.

<![if !supportEmptyParas]><![endif]>

For example, 5'-UUA can be used to encode Leu 90% of the time (as determined by the nucleotide sequences of many genes). You can never use CUR, and the combination of UUG plus CUY can represent 10% of the codons.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

2. tRNA abundance correlates with codon usage in natural mRNA

<![if !supportEmptyParas]><![endif]>

In this example, the tRNAleuwith 3' AAU in the anticodon will be most common.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

3. The codon usage pattern can be asignalsPeople's levels of expression. In general, the most expressed genes tend to use codons that are commonly used in genes in the rest of the genome. This was quantified as the "codon match index".Thus, on genome-wide analysis, a previously unknown gene whose codon usage profile matches the preferred codon usage for the organism would score high on the codon adaptation index and would be suggested as highly vocalized. Likewise, one with a low index value may encode a low-abundance protein.

<![if !supportEmptyParas]><![endif]>

The observation of a gene with a pattern of codon usage that differs significantly from the rest of the genome indicates that this gene may have entered the genome by horizontal transfer from another species.

<![if !supportEmptyParas]><![endif]>

4. The use of preferred codons is a useful consideration in "reverse genetics". Even if you know a partial amino acid sequence for a protein and want to isolate the gene for it, the family of mRNA sequences that can encode that amino acid sequence can be easily determined. Due to code degeneracy, this family of sequences can be very large. Since these sequences are likely to be used as hybridization probes or as PCR primers, the larger the family of possible sequences, the more likely it is that hybridization with a target sequence other than the desired one can be obtained. Therefore, it is desired to limit the number of possible sequences, and by consulting a table of codon preferences (assuming they are known for the organism of interest), preferred codons can be used rather than all possible codons. This limits the number of sequences to be made as primers or hybridization probes.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

MI. Wobblein das Anticodon

<![if !supportEmptyParas]><![endif]>

1. Definition

<![if !supportEmptyParas]><![endif]>

"Flutter"is the term used to refer to the fact thatNon-Watson crickbase pairing is allowed between the 3rd position of the codon and the 1st position of the anticodon. In contrast, the first two positions of the codon form regular Watson-Crick base pairs with the last two positions of the anticodon.

<![if !supportEmptyParas]><![endif]>

This flexibility in the "wobble" position allows some tRNAs to pair with two or three codons, thereby reducing the amount of tRNA needed for translation.

<![if !supportEmptyParas]><![endif]>

The following "wobble" rules mean that all 61 codons (for 20 amino acids) can be read by only 31 anticodons (or 31 tRNAs).

<![if !supportEmptyParas]><![endif]>

2. oscillation rules

In addition to the usual base pairscan have pairs G-U and I in the first position of the anticodon can pair with U, Color A.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

5'-Anticodon base = 3'Codon Base =

first position on tRNA third position in mRNA

C GRAMS

ONE you

you To G

GRAMS chorus you

you U, C o A

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Figure 3.4.2.

<![if !supportEmptyParas]><![endif]>

<![si !vml]>Part Three: Gene Expression and Protein Synthesis (3)<![finish]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

F. types of mutations

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

1. basic replacement

<![if !supportEmptyParas]><![endif]>

This has already been covered in part 2, DNA repair.As a reminder, there are two types of base substitutions.

<![if !supportEmptyParas]><![endif]>

(1) transitions: A purine replaces a purine or a pyrimidine replaces another pyrimidine. The same class of nucleotide residues. Examples are A replacing G or C replacing T.

<![if !supportEmptyParas]><![endif]>

(2) transverse: A purine replaces a pyrimidine or a pyrimidine replaces a purine. A different class of nucleotides is inserted into the DNA and the helix becomes distorted (especially in a purine-purine base pair). Examples are A replacing T or C, or C replacing A or G.

<![if !supportEmptyParas]><![endif]>

During evolution, the rate of construction of transitions exceeds the rate of construction of transversions.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

2. Effect of mutations on mRNA

<![if !supportEmptyParas]><![endif]>

(1) meaningless mutationscause the substitution of an amino acid. Depending on the particular surrogate, it may or may not have a detectable phenotypic consequence. Some replacements, eg. a valine for amleucine in an important position to maintain aone-Helix, must not cause any detectable change in protein structure or function. Other substitutions, such as valine for a glutamate at a site that causes hemoglobin to polymerize in the deoxygenated state, cause significant pathology (sickle cell disease in this example).

<![if !supportEmptyParas]><![endif]>

(2) meaningless mutationscause the translation to stop prematurely. They occur when a substitution, insertion, or deletion creates a stop codon in the mRNA within the region encoding the polypeptide in the wild-type mRNA. They almost always have severe phenotypic consequences.

<![if !supportEmptyParas]><![endif]>

(3) frameshift mutationsare insertions or deletions that change the reading frame of the mRNA. They almost always have severe phenotypic consequences.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

C. Not all base substitutions change the encoded amino acids.

<![if !supportEmptyParas]><![endif]>

(1) Base substitution can result in a change in the encoded polypeptide sequence, in which case the substitution is calledis not synonymousothey are not silent.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

(2) If the base substitution occurs at a degenerate position in the codon such that the encoded amino acid does not change, it is calledequivalentoIn silencereplacement.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Z.B. ONECU-> AONEyou non-synonymous substitution

Thr ‑> Asn

<![if !supportEmptyParas]><![endif]>

C.A.you->CAC Synonym replacement

Thr ‑> Thr

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

(3) Examination of degeneracy patterns in the genetic code shows that non-synonymous substitutions occur primarily in the first and second position of the codon, while synonymous substitutions occur primarily in the third position.However, there are several exceptions to this rule.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

(4) In general, the rate of fixation of synonymous substitutions in a population is significantly greater than the rate of fixation of non-synonymous substitutions.This is one of the strongest supporting arguments for the model of neutral evolution or evolutionary drift as the main cause of observed substitutions in natural populations.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.1 How is the enzyme polynucleotide phosphorylase different from DNA and RNA polymerases?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.2 A small oligopeptide is encoded in this RNA sequence.

<![if !supportEmptyParas]><![endif]>

5' GACUAUGCUCAUAUUGGUCCUUUGACAAG

<![if !supportEmptyParas]><![endif]>

a) Where does it start and end and how many amino acids are encoded?

b) What's unusual about encoded amino acids?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.3 a) What does degeneration in the genetic code mean?

b) What codon position usually shows degeneracy?

C) How can this save the amount of tRNA in a cell?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.4 (POB)Encoding of a polypeptide by DNA duplex

The template strand of a double-stranded DNA sample contains the sequence:

<![if !supportEmptyParas]><![endif]>

(5')CTTAACACCCCTGACTTCGCGCGTCG

<![if !supportEmptyParas]><![endif]>

a) What is the mRNA base sequence that can be transcribed from this strand?

b) Starting at the 5' end, what amino acid sequence can be encoded by the mRNA base sequence in (a)?

C) Assume that the other (non-template) strand of this DNA sample is transcribed and translated. Will the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.5 The basis of the sickle cell mutation.

In sickle cell hemoglobin there is a Val residue at position 6 ofb- globin chain, rather than the Glu residue found at this position in normal hemoglobin A.Can you predict what change occurred in the DNA codon for glutamate to explain the valine substitution?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.6 A codon for lysine (Lys) can be converted to a codon for isoleucine (Ile) by a single nucleotide substitution. What is the original codon sequence for Lys?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.7 This question reports the effects of single nucleotide substitutions on the amino acid encoded by a given codon. In each case, deduce the wild-type codon sequence.

<![if !supportEmptyParas]><![endif]>

a) Gln becomes Arg, which then becomes Trp.What is the codon for Gln?

b) Leu can be converted to Ser, Val or Met by a single nucleotide substitution (a different nucleotide substitution for each amino acid change). What is the Leu codon?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.8 Using the common genetic code and considering "wiggle" what is it?MinimumNumber of tRNAs needed to recognize the codons for

<![if !supportEmptyParas]><![endif]>

a) arginine?

b) Responder?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.9 Determine which amino acid should be added to tRNAs with the following anticodons:

<![if !supportEmptyParas]><![endif]>

a) 5'-ICC-3'

b) 5'-G-A-U-3'

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.10 (POB) Identification of the gene of a protein with known amino acid sequence.

Design a DNA probe that allows you to identify the gene that encodes a protein with the following amino acid sequence at the amino terminus. The probe should be 18-20 nucleotides in length, a size that provides adequate specificity given sufficient homology between the probe and the gene.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

H3norte+-Ala-Pro-Met-Thr-Trp-Tyr-Cys-Met-Asp-Trp-Ile-Ala-Gly-Gly-Pro-Trp-Phe-Arg-Lys-Asn-Thr-Lys ---

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

13.11 Suppose you are on the Starship Enterprise in Alab.One of the "visiting teams" visited Planet Claire and brought back a mushroom that is the star of this week's episode. While the rest of the team tries to figure out whether the fungus is friend or foe (and gets all the camera time), you're tasked with determining its genetic code. With today's technologies, two centuries from now, you'll immediately discover that your proteins are composed of just eight amino acids, which we'll simply call amino acids 1, 2, 3, 4, 5, 6, 7, and 8.Its genetic material is a nucleic acid that contains only three nucleotides, called K, N and D, which are not found in terrestrial nucleic acids.

<![if !supportEmptyParas]><![endif]>

The results of frameshift mutations confirm the suspicion that this fungus actually uses the smallest possible coding unit.Insertions of one or three nucleotides into a gene cause complete loss of function, but insertions or deletions of two nucleotides have little effect on the encoded protein.

<![if !supportEmptyParas]><![endif]>

They make synthetic polymers from the K, N, and D nucleotides and use them to program protein synthesis. The amino acids incorporated into the proteins controlled by each of the polynucleotide templates are shown below. Assume that models are read from left to right.

<![if !supportEmptyParas]><![endif]>

model Incorporated amino acid(s)

<![if !supportEmptyParas]><![endif]>

knorte= KKKKKKKK 1

<![if !supportEmptyParas]><![endif]>

nortenorte= NNNNNNNNNN 2

<![if !supportEmptyParas]><![endif]>

Dnorte= DDDDDDDDDD 3

<![if !supportEmptyParas]><![endif]>

(KN)norte= KNKNKNKNKN 4 e 5

<![if !supportEmptyParas]><![endif]>

(KD)norte= KDKDKDKDKD 6 years 7

<![if !supportEmptyParas]><![endif]>

(DAKOTA DO NORTE)norte= NDNDNDNDND 8

<![if !supportEmptyParas]><![endif]>

(KND)norte= KNDKNDKNDKND 4 and 6 and 8

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Lieutenant Data says that's all you need to crack the code, but to see for yourself, examine some mutants of the fungus and find that a single nucleotide change in a codon for amino acid 6 changes it to a codon for 5 amino acid that can convert. Also, a single nucleotide change in an 8 amino acid codon can convert it to a 7 amino acid codon.

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

Report your findings about the genetic code used in the fungus on Planet Claire.

<![if !supportEmptyParas]><![endif]>

a) How long is a codon?

<![if !supportEmptyParas]><![endif]>

b) Is the code degenerate?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

C) What is (are) the codon(s) for the eight amino acids?

<![if !supportEmptyParas]><![endif]>

<![if !supportEmptyParas]><![endif]>

amino acids code(s)

<![if !supportEmptyParas]><![endif]>

1

2

3

4

5

6

7

8

<![if !supportEmptyParas]><![endif]>

d) What is the translation stop sign?

mi) What is the mutation that changes a 6 amino acid codon to a 5 amino acid codon? Show the start codon and the mutated codon.

F) What is the mutation that changes an 8 amino acid codon to a 7 amino acid codon? Show the start codon and the mutated codon.

<![if !supportEmptyParas]><![endif]>

Top Articles
Latest Posts
Article information

Author: Sen. Emmett Berge

Last Updated: 02/25/2023

Views: 5679

Rating: 5 / 5 (60 voted)

Reviews: 83% of readers found this page helpful

Author information

Name: Sen. Emmett Berge

Birthday: 1993-06-17

Address: 787 Elvis Divide, Port Brice, OH 24507-6802

Phone: +9779049645255

Job: Senior Healthcare Specialist

Hobby: Cycling, Model building, Kitesurfing, Origami, Lapidary, Dance, Basketball

Introduction: My name is Sen. Emmett Berge, I am a funny, vast, charming, courageous, enthusiastic, jolly, famous person who loves writing and wants to share my knowledge and understanding with you.